Published in:
01-11-2017 | Original Article
A 23-Nucleotide Deletion in STK11 Gene Causes Peutz–Jeghers Syndrome and Malignancy in a Chinese Patient Without a Positive Family History
Authors:
Zi-Ye Zhao, Yu-Liang Jiang, Bai-Rong Li, Fu Yang, Jing Li, Xiao-Wei Jin, Shou-Bin Ning, Shu-Han Sun
Published in:
Digestive Diseases and Sciences
|
Issue 11/2017
Login to get access
Abstract
Background and Aims
Peutz–Jeghers syndrome (PJS) is an autosomal-dominant genetic disease caused by mutations in the tumor suppressor gene, STK11, which is characterized by gastrointestinal hamartomas, melanin spots on the lips and the extremities, and an increased risk of developing both gastrointestinal and extraintestinal malignancies.
Methods and Results
We treated a PJS patient without a positive family history, who possessed typical clinical manifestations including polyp canceration. In order to explore the genotype of this patient, blood samples were collected from all the available family members. The whole coding region and the flanking regions of the STK11 gene were amplified by polymerase chain reaction and analyzed by Sanger sequencing. Molecular analysis of the STK11 gene here revealed a 23-nucleotide deletion (c.426–448delCGTGCCGGAGAAGCGTTTCCCAG) in exon 3, resulting in a change of 13 codons and a truncating protein (p.S142SfsX13). This mutation was not found in normal individuals in this family including her parents or in 100 control individuals. Protein structure prediction indicated a dramatic loss of the kinase domain and complete loss of the C-terminal regulatory domain.
Conclusions
The results presented here enlarge the spectrum of STK11 mutation both disease-causing and malignancy-causing.