Figures
Abstract
Estrogen is traditionally thought to exert genomic actions through members of the nuclear receptor family. Here, we investigated the rapid nongenomic effects of 17β-estradiol (E2) on tumor necrosis factor α (TNF-α) production following lipopolysaccharide (LPS) stimulation in mouse bone marrow-derived macrophages (BMMs). We found that LPS induced TNF-α production in BMMs via phosphorylation of p38 mitogen-activated protein kinase (MAPK). E2 itself did not affect the MAPK pathway, although it attenuated LPS-induced TNF-α production through suppression of p38 MAPK activation. Recently, G protein-coupled receptor 30 (GPR30) was suggested to be a membrane estrogen receptor (mER) that can mediate nongenomic estradiol signaling. We found that BMMs expressed both intracellular estrogen receptors (iER) and mER GPR30. The specific GPR30 antagonist G-15 significantly blocked effects of estradiol on LPS-induced TNF-α production, whereas an iER antagonist did not. Moreover, E2 induced a rapid rise in intracellular free Ca2+ that was due to the influx of extracellular Ca2+ and was not inhibited by an iER antagonist or silencing of iER. Ca2+ influx was also induced by an impermeable E2 conjugated to BSA (E2-BSA), which has been used to investigate the nongenomic effects of estrogen. Consequently, Ca2+, a pivotal factor in E2-stimulated nongenomic action, was identified as the key mediator. The inhibitory effects of E2 on LPS-induced TNF-α production and p38 MAPK phosphorylation were dependent on E2-triggered Ca2+ influx because BAPTA, an intracellular Ca2+ chelator, prevented these effects. Taken together, these data indicate that E2 can down-regulate LPS-induced TNF-α production via blockade of p38 MAPK phosphorylation through the mER-mediated nongenomic Ca2+ signaling pathway in BMMs.
Citation: Liu L, Zhao Y, Xie K, Sun X, Gao Y, Wang Z (2013) Estrogen-Induced Nongenomic Calcium Signaling Inhibits Lipopolysaccharide-Stimulated Tumor Necrosis Factor α Production in Macrophages. PLoS ONE 8(12): e83072. https://doi.org/10.1371/journal.pone.0083072
Editor: Yulia Komarova, University of Illinois at Chicago, United States of America
Received: July 19, 2013; Accepted: November 7, 2013; Published: December 23, 2013
Copyright: © 2013 Liu et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This study is supported by grants from National Natural Science Foundation of China (No. 31000630) and Natural Science Foundation of Jiangsu Province (No. BK2010217). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exist.
Introduction
In addition to its pivotal role in sexual development and reproduction, the sexual steroid hormone estrogen has been reported to regulate numerous immune and inflammatory responses, especially during autoimmune and infectious pathophysiological processes [1]–[3]. These actions of estrogen are thought to mainly result from its specific effects on the different cellular components of the immune system because most, if not all, of these components have been demonstrated to express estrogen receptors [4]–[6]. Macrophages are important in the immune-modulatory role of estrogen [4]. There is a wealth of clinical and laboratory data demonstrating that sex hormones affect the immune system by modulating the function of the monocyte-macrophage system by mechanisms that include macrophage activation and synthesis of cytokines [7], [8]. The control of the production of macrophage cytokines can greatly facilitate the treatment of many immunoinflammatory diseases such as septic shock, rheumatoid arthritis, cerebral malaria, and autoimmune diabetes [9], [10].
Macrophages exhibit a particularly vigorous response to lipopolysaccharide (LPS), which is a potent activator of the immune system that induces a variety of inflammatory modulators such as tumor necrosis factor α (TNF-α), nitric oxide, interleukin-1, interleukin-6, and prostaglandins [11]. TNF-α is a pluripotent cytokine that is produced predominantly by activated macrophages and has multiple biologic effects including cell differentiation, proliferation, and multiple pro-inflammatory effects. Deregulated TNF-α production has been correlated with numerous autoimmune disorders, including rheumatoid arthritis and systemic lupus erythematosus [12], [13]. In response to LPS, the mitogen-activated protein kinase (MAPK) cascades are activated in macrophage [14], [15]. MAPKs are signaling molecules that play important roles in the regulation of immune responses including cell activation and cytokine production. There are three major MAPK dependent pathways: p38 MAPK, extracellular-regulated protein kinase (ERK) 1/2, and c-Jun NH2-terminal kinase (JNK). The phosphorylated MAPKs transduce their signals downstream and promote activation and translocation of transcription factors that subsequently regulate the expression of different cytokine genes and the biological functions of cells [16]–[18].
In recent years, the investigation of estrogen-induced signaling pathways in LPS-activated macrophages has been important and necessary for discovering potential therapeutic targets and drug for immunoinflammatory diseases. The main endogenous estrogen, 17β-estradiol (E2), has traditionally been thought to mediate its effects via intracellular estrogen receptors (iER) that are located in the cytoplasm or on the nuclear membrane; thus, studies have investigated the effect of E2 on transcription factors in the regulation of target genes [19], [20]. However, recent findings indicate that E2 also acts on the plasma membrane to initiate signaling pathways in the cytoplasm and regulate cellular functions, and these pathways are referred to as nongenomic. These nongenomic effects of E2 that are mediated by membrane estrogen receptors (mER), or perhaps other ligands, can induce the generation of the second messengers Ca2+ and nitric oxide and activate several signaling pathways [21]–[24]. Primary macrophages have been shown to express G protein-coupled receptor 30 (GPR30), which may function as a novel transmembrane estrogen receptor and can mediate rapid nongenomic events. Estrogen may utilize this non-classical estrogen receptor to limit potentially lethal inflammatory responses. [25]
Although E2 produces salutary effects on macrophage activation and the synthesis of cytokines, the precise molecular mechanisms of these effects are still unknown. In the present study, we examined the effect of E2 on TNF-α production and explored the molecular mechanism of this effect in LPS-stimulated mouse bone marrow-derived macrophages (BMMs). Our data indicate that E2 can down-regulate LPS-induced TNF-α production via blockade of p38 MAPK phosphorylation through the mER-mediated nongenomic Ca2+ signaling pathway in BMMs. Investigation of the mechanism by which estrogen induces the synthesis of cytokines in macrophages is important and necessary for discovering potential therapeutic targets and treating various immunoinflammatory diseases.
Materials and Methods
Ethics Statement
All animal work was conducted in adherence to the guidelines of the Chinese Ministry of Science and the Technique for Accreditation of Laboratory Animal Care and was approved by the Institutional Animal Care and Use Committee of Soochow University.
Reagents
RPMI 1640 and FBS were purchased from HyClone (Logan, UT, USA). LPS, E2, E2 conjugated to BSA (E2-BSA), E2-BSA-FITC, BAPTA, tamoxifen, ICI 182780, Fura-2/acetoxymethylester and other chemical reagents were purchased from Sigma (St. Louis, MO, USA). Anti-ERα, anti-ERβ, anti-GPR30, and HRP and FITC-conjugated secondary antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). The specific GPR30 inhibitor G-15 was purchased from Millipore (Darmstadt, Germany). SB203580, PD98059, SP600125, the antibodies against p38, phospho-p38, ERK 1/2, phospho-ERK 1/2, JNK, and phospho-JNK were purchased from Cell Signaling Technology (MA, USA). F4/80 antibody-FITC was from Serotec (Oxford, UK). Before treatment, E2 and E2-BSA were tested for LPS contamination using a Limulus amebocyte lysate assay (Biowhittaker, Walkersville, MD), and the level of endotoxin was found to be insignificant.
Mice
C57BL/6j mice were obtained from Shanghai Experimental Animal Center of the Chinese Academy (Shanghai, P. R. China). Mice received a standard diet and water ad libitum, and the protocol was fully approved by the Chinese Ministry of Science and was in accordance with the Technique for Accreditation of Laboratory Animal Care. Mice were sacrificed by cervical dislocation.
Preparation and culture of BMMs
Murine bone marrow cells were obtained from three-week old male C57BL/6j mice by flushing the femurs as previously described [26]. Bone marrow cells were grown in RPMI 1640 complete medium supplemented with 15% (v/v) L929 cell-conditioned medium as a source of macrophage- and monocyte-colony stimulating factor in 37°C and 5% CO2 under saturated humidity conditions. On day 5, bone marrow cells were harvested by scraping. The FITC-conjugated antibody F4/80 was used as a membrane surface marker that is specific for macrophages and was added at 10 µg/106 cells. After incubation for 30 min on ice in the dark, the cells were washed again and resuspended in PBS. F4/80-positive bone marrow cells (BMMs) were sorted with a FACSCalibur (Becton Dickinson, USA) flow cytometer and replated in 6-well dishes at 37°C, 5% CO2, and 96% humidity for further culturing. The cells were cultured in phenol red-free RPMI 1640 containing 10% charcoal-dextran FBS for 48 h before treatment.
Real-time PCR
Total RNA was prepared using Trizol reagent (Invitrogen) according to the manufacturer's instruction. The mRNA expression of ER was analyzed by real-time PCR performed with an Applied Biosystems 7300 Real-Time PCR system using SYBR Green PCR Core Reagents (Applied Biosystems). The primers used for ERα were as follows: GCCGAGGAGGGAGAATGTTG (sence) and CGCCAGACGAGACCAATCAT (antisence). The primers used for ERβ were as follows: CATCAGTAACAAGGGCATGG (sence) and CACTGAGACTGTAGGTTCTG (antisence). The samples were amplified with a two-step reaction at 95°C for 15 s and 64°C for 1 min for 40 cycles. Relative quantitative evaluation of target gene levels was performed by comparing ΔCt, where Ct is the threshold concentration. Product accumulation was measured during the extension phase, and all samples were run in triplicate.
ER silencing
Cells were transfected with 50 nM ERα siRNA, ERβ siRNA, or control siRNA (Invitrogen, CA, USA) in Lipofectamine RNAimax (Invitrogen, CA, USA) according to the manufacturer's instructions. After 72 h of transfection, the cells were switched to phenol red-free RPMI 1640 supplemented with 10% charcoal-stripped FBS for 48 h before being harvested.
Preparation of subcellular fractions
Cells were suspended in HEPES buffer followed by sonication for 10 sec on a sonicator. The homogenate was centrifuged at 1000× g for 7 min to pellet the nuclear material, and the resulting supernatant was centrifuged at 20, 000× g for 20 min to pellet the membrane fraction. Cytoplasmic fractions were obtained by centrifugation at 100,000× g for 1 h of the remaining supernatant after the 20,000× g spin. Subcellular fractions were stored at −80°C for up to 2 d before analysis.
Western blotting
Aliquots containing 30 µg of protein were subjected 10% SDS-PAGE, followed by electrotransfer to PVDF membranes (Millipore, MA, USA). Blots were probed with primary antibody for 2 h at a dilution of 1∶1000, followed by incubation with HRP-conjugated secondary antibody for 1 h at a dilution of 1∶10000. Detection was performed using the enhanced chemiluminescence system (Biocolors, Shanghai, PR China). Images were scanned, and signal density was quantified using the ChemiImager 5500 imaging software (Alpha Innotech, San Leandro, CA, USA).
Flow cytometry
Both intact and permeabilized cells (prefixed with 0.5% paraformaldehyde) were incubated with anti-ERα or anti-ERβ antibody (1∶150, 30 min) followed by FITC-conjugated secondary antibody (1∶320, 30 min). Nonpermeabilized cells were pretreated with E2-BSA-FITC (1×10−6 M) or with BSA-FITC alone as control for 30 min and then fixed with paraformaldehyde. Nonpermeabilized cells were pretreated with anti-GPR30 (1∶150, 30 min) followed by FITC-conjugated secondary antibody and then fixed with paraformaldehyde. Flurescence intensity was analyzed with a FACScan (Becton Dickinson, USA), and samples of 10,000 cells were gated on the basis of forward and side scatter. The data were evaluated using Cellquest software according to the manufacturer's instructions.
Confocal laser scanning microscopy (CLSM)
Cells were allowed to adhere onto coverslips overnight and then incubated with anti-ER antibody, anti-GPR30 antibody, or E2-BSA-FITC as described above. The coverslips were mounted onto slides and analyzed with LEICA TCS NT CLSM version 1.5.451 (Leica Lasertechnik, Heidelberg, Germany) with FITC fluorescence excitation at 488 nm.
Measurement of intracellular Ca2+
Cells were incubated with 3 µM Fura-2/acetoxymethylester for 35 min in HEPES buffer. Intracellular Ca2+ was detected using a Hitachi F-4500 spectrofluorometer with Fura-2 fluorescence excitation at 340/380 nm and emission at 510 nm. Intracellular free Ca2+ concentration ([Ca2+]i) were computed from the ratio of 340 to 380 nm fluorescence values using the equation as described previously [27].
Results
Effect of p38 MAPK on LPS-induced TNF-α production in BMMs
The ability of LPS to stimulate the release of TNF-α was studied in BMMs using ELISA. Figure 1A shows that the production of TNF-α was dose dependently up-regulated in BMMs after 24 h of LPS stimulation. Increases were maximal at a concentration of 1 µg/ml. The MAPK pathway is known to play a substantial role in LPS-induced cytokine production in macrophages [14], [15]. To determine MAPK activation, the phosphorylation of p38 MAPK, ERK1/2, and JNK in BMMs with or without LPS stimulation were evaluated with western blotting. Our results revealed that, after stimulation with 1 µg/ml LPS, the phosphorylation of ERK1/2, p38 MAPK, and JNK in BMMs were significantly increased within 15 min (Figure 1B). To determine which of these kinases was relevant to the enhanced LPS-induced TNF-α production in BMMs, inhibitor studies were performed. Cells were cultured with MAPK inhibitor for 1 h before stimulation with 1 µg/ml LPS for 24 h. As shown in Figure 1C, SB203580, a specific inhibitor of p38 MAPK, significantly suppressed the LPS-induced production of TNF-α in BMMs as assessed by ELISA. However, the ERK1/2 inhibitor PD90859 and the JNK inhibitor SP600125 did not alter LPS-induced TNF-α production in BMMs.
(A) Cells were treated with different concentrations of LPS for 24 h. Secretion of TNF-α in culture supernatants was detected using ELISA. The results are expressed as the means ± the SEMs of three independent experiments. (B) The cells were treated with LPS (1 µg/ml) for different periods. Protein extracts were subjected to western blotting to detect the phosphorylated and total forms of three MAPK molecules, p38 MAPK, ERK1/2 and JNK, using anti-MAPK antibody. Stimulation with anisomycin (AN, 10 µg/ml for 30 min) was used as a positive control. Representative blots are shown, and the results were verified by at least three independent experiments. (C) Cells were pretreated with specific inhibitors of p38 MAPK (SB203580, 20 µM), ERK1/2 (PD98059, 20 µM) or JNK (SP600125, 20 µM) for 30 min and then exposed to LPS (1 µg/ml) for 24 h. Secretion of TNF-α in culture supernatants was detected using ELISA. The results are expressed as the means ± SEMs of three independent experiments. *P<0.05 compared to the control.
E2 down-regulates LPS-induced TNF-α production in BMMs
To examine the effects E2 of on LPS-induced TNF-α production in BMMs, cells were incubated with different concentrations of E2 for 24 h, with or without LPS costimulation (1 µg/ml). As shown in Figure 2A, E2 significantly inhibited LPS-induced TNF-α production, and the maximum effect occurred at a physiological concentration of 1 nM. E2 by itself did not affect TNF-α production. We subsequently evaluated the effects of E2 on the LPS-induced phosphorylation of p38 MAPK, ERK1/2, and JNK. As shown in Figure 2B, E2 was not able to activate any of the three MAPK families at different time points over 2 h as detected by western blotting using specific anti-MAPK antibodies. However, costimulation with 1 nM E2 dramatically reduced the LPS-induced phosphorylation of p38 MAPK without altering total protein expression (Figure 2C). In contrast, E2 did not affect the LPS-induced activation of ERK1/2 and JNK (data not shown).
(A) Cells were treated with LPS (1 µg/ml) alone or in combination with different concentrations of E2 for 24 h, and the culture media were collected to measure TNF-α concentrations using ELISA. The relative expression of TNF-α was evaluated with the results obtained from LPS-stimulated macrophages. The results are expressed as the means ± the SEMs of three independent experiments. (B) Cells were treated with E2 (1 nM) for different periods. Protein extracts were subjected to western blotting to detect the phosphorylated and total forms of three MAPK molecules, p38 MAPK, ERK1/2 and JNK. Stimulation of the cells with anisomycin (AN, 10 µg/ml, 30 min) was used as a positive control. (C) Cells were stimulated with LPS (1 µg/ml) alone or in combination with E2 (1 nM) for 15 min. Protein extracts were subjected to western blotting to detect the phosphorylated and total forms of p38 MAPK. The relative activation of p38 was densitometrically evaluated. Representative blots are shown, and the results were verified by at least three independent experiments. *P<0.05 compared to the control and LPS.
Expression of iER in BMMs
Most, if not all, of the effects of estrogen are mediated by two members of the nuclear receptor superfamily: ERα and ERβ [5], [6]. The expression of intracellular ERα and ERβ in BMMs was detected. Using real-time PCR, we demonstrated that ERα mRNA was expressed at higher levels than ERβ in BMMs (Figure 3A). Consistent with these findings, total ERα protein levels were higher in BMMs as determined by western blotting (Figure 3B). Moreover, incubation of BMMs with the same ER antibody and FITC-conjugated secondary antibody produced significant labeling of permeabilized cells as detected by flow cytometry (Figure 3C). The majority of ER was localized in the cytoplasm of the BMMs, whereas the nuclei remained unlabeled as revealed by CLSM (Figure 3D).
(A) Real-time PCR analyses of ERα and ERβ mRNA from BMMs. The expression levels of these receptors are given as arbitrary units normalized to 18S rRNA expression. (B) Western blotting analyses of ERα and ERβ proteins from BMMs and mouse uterus. The relative expression of ER was densitometrically evaluated. (C) Flow cytometry of intact and permeabilized cells labeled with anti-ERα or anti-ERβ antibody followed by FITC-conjugated secondary antibody or by FITC-conjugated secondary antibody only. (D) Confocal laser scanning microscopy of intact and permeabilized cells labeled with anti-ERα or anti-ERβ antibody followed by FITC-conjugated secondary antibody. The results were verified by at least three independent experiments. The bar indicates 10 µm. *P<0.05 compared to the ERα.
Expression of mER in BMMs
Estrogen also acts on the plasma membrane to initiate rapid signaling pathways in the cytoplasm and regulate cellular functions, and these mechanisms are referred to as the nongenomic pathway [21]–[24]. Here, using the cell-impermeable E2-BSA-FITC, we examined whether there was any estrogen binding at the surface of BMMs. After incubation with E2-BSA-FITC for 30 min, the cells exhibited a significant increase in fluorescence intensity compared to the controls as determined by flow cytometry (Figure 4A). Control treatment with BSA-FITC did not produce any binding activity, which suggests the membrane binding we observed was due specifically to E2 and not BSA. Furthermore, CLSM revealed specific membrane staining for E2-BSA-FITC, and the outline of a single cell is shown in Figure 4B. The expression of GPR30 on the surfaces of intact BMMs was also evaluated by flow cytometry (Figure 4A) and CLSM (Figure 4B), and the fluorescence pattern was identical to that observed with E2-BSA-FITC incubation. Consistent with these findings, western blotting analysis demonstrated that the GPR30 protein was retained within plasma membrane fraction (Figure 4C).
(A) Flow cytometry and (B) confocal laser scanning microscopy analyses of membrane estrogen receptors in BMMs. Intact cells labeled with E2-BSA-FITC or BSA-FITC alone as a control. For GPR30 detection, intact cells were pretreated with anti-GPR30 followed by FITC-conjugated secondary antibody. (C) Western blotting analyses of GPR30 protein from the membrane (mem), cytoplasmic (cyt), or nuclear (nu) fractions of BMMs. The results were verified by at least three independent experiments. The bar indicates 10 µm.
To establish the specificity of E2-BSA-FITC binding, BMMs were incubated for 15 min with E2-BSA-FITC in the presence or absence of 10-fold excess of various agents, and fluorescence intensities were subsequently analyzed by flow cytometry. As shown in Figure 5, the binding of E2-BSA-FITC were competitively attenuated by E2 and E2-BSA. This membrane binding site for estrogen is not related to the classical iER because the iER inhibitors tamoxifen and ICI 182780 did not block of E2-BSA-FITC binding. Furthermore, the specific GPR30 inhibitor G-15 was an effective competitor and significantly reduced the fluorescence intensity of surface-bound E2-BSA-FITC.
Cells were incubated for 152-BSA-FITC (1×10−6 M) in the absence (control) or in the presence of a 10-fold excess of different unlabeled materials: 17β-estradiol (E2), E2-BSA, tamoxifen (Ta), ICI 182780 (ICI), or G-15. Fluorescence intensity was analyzed by flow cytometry. The results were verified by at least three independent experiments.
17β-estradiol induced Ca2+ signaling via the mERs of BMMs
Estrogens have been shown to induce the rapid activation of kinase-signalling cascades and to modulate intracellular Ca2+ levels. These effects are considered to be nongenomic because they are too rapid to involve changes in gene transcription [24]. The effects of E2 on the intracellular Ca2+ levels of BMMs were investigated using Fura-2/acetoxymethylester and fluorescence spetrophotometry. As shown in Figure 6A, E2 induced a rapid and sustained increase in [Ca2+]i in the BMMs. To evaluate whether this effect of estrogen was mediated by extracellular membrane receptors, we tested the effect of E2-BSA on BMMs. Figure 6B shows that E2-BSA induced intracellular Ca2+ increases and that this response was similar to that obtained with free E2. BSA alone did not produce any change in [Ca2+]i. If iERs are responsible for the E2-induced Ca2+ increase in BMMs, this increase should be blocked by tamoxifen, which is an antagonist of iER. However, Ca2+ elevations were not affected by 30 min of preincubation of the cells with tamoxifen (Figure 6C). Moreover, knock down of the iERs using siRNA did not block the E2-induced Ca2+ increase (Figure 6D). The increase in [Ca2+]i was the result of either extracellular Ca2+ influx through the plasma membrane or intracellular Ca2+ release from endoplasmic reticulum. Thus, we blocked the release of Ca2+ from intracellular stores with neomycin, a phospholipase C inhibitor, and this treatment did not prevent the E2-induced rise in [Ca2+]i (Figure 6E). When extracellular Ca2+ was removed by adding EGTA before E2, the E2-induced [Ca2+]i elevation was completely abolished (Figure 6F). The above results indicate that the E2-induced increase in [Ca2+]i was due to an influx of extracellular Ca2+. This influx was channel-mediated because increasing doses of the Ca2+ channel blocker Ni2+ caused gradual decreases in E2-induced Ca2+ influxes, and 5 mM Ni2+ completely blocked the influx of Ca2+ (Figure 6G). LPS stimulation did not induce calcium influx in BMMs. (Figure 6H).
(A) Effects of 17β-estradiol (E2) and vehicle on [Ca2+]i. (B) Effects of E2-BSA and BSA alone (as a control) on [Ca2+]i. (C) Cells were pretreated with tamoxifen for 30 min before adding E2. (D) Effects of E2 on [Ca2+]i in SiER-transfected BMMs. (E) Cells were preincubated with neomycin for 5 min before adding E2. (F) Cells were preincubated with EGTA for 1 min before adding E2. (G) Cells were preincubated with different doses of Ni2+ for 5 min before adding E2. (H) Effects of LPS on [Ca2+]i. The results were verified by at least three independent experiments. Arrows in each curve indicate the addition of substances to the BMMs suspensions.
E2 down-regulates LPS-stimulated TNF-α production through a nongenomic signaling pathway in BMMs
To further explore the mechanism of the inhibitory effect of E2 on LPS-induced TNF-α production in BMMs, cells were pretreated with the iER antagonist tamoxifen or ICI 182780 for 30 min before the addition of E2 and LPS. As shown in Figure 7A, E2 attenuated LPS-induced TNF-α production, and this inhibitory effect was not antagonized by tamoxifen or ICI 182780. These data indicate that E2 attenuates LPS-induced TNF-α secretion in an iER-independent manner in BMMs. In contrast, the impermeable E2-BSA exerted an inhibitory effect on LPS-induced TNF-α secretion that was similar to that of E2, and BSA did not produce any change in LPS-induced TNF-α production. Furthermore, the specific GPR30 antagonist G-15 significantly blocked the effect of estradiol on LPS-induced TNF-α production. These data suggest that the effect of E2 in LPS-induced TNF-α production is mediated through mERs.
(A) Cells were incubated for 24 h with 1 µg/ml LPS alone or in the presence of BSA (10 nM), 17β-estradiol (E2, 1 nM), E2-BSA (10 nM), E2 plus a 10-fold excess of tamoxifen (Ta), ICI 182780 (ICI), or G-15. (B) Cells were preincubated with BAPTA (10 µM) or SB203580 (SB, 20 µM) for 30 min before the addition of LPS (1 µg/ml) or LPS plus E2 (1 nM) for 24 h. The culture media were collected to measure TNF-α concentrations using ELISA. The relative expression of TNF-α was evaluated with results obtained from LPS-stimulated macrophages. The results are expressed as the means ± the SEMs from three independent experiments. *P<0.05 compared to the LPS control.
When BMMs were preincubated with intracellular Ca2+ chelator BAPTA, the inhibitory effect of E2 on LPS-induced TNF-α production was abrogated, which suggests that Ca2+ is involved in this effect of E2 (Figure 7B). We know that the effect of estradiol in LPS-stimulated TNF-α production in BMMs is mediated through p38 MAPK. In the present study, when LPS-induced TNF-α production was abolished by SB 203580, the remaining TNF-α production was no longer regulated by E2 (Figure 7B). Moreover, the inhibitory effect of E2 on LPS-induced p38 MAPK phosphorylation was abrogated by BAPTA but not by an iER antagonist or siRNA as demonstrated in western blotting analyses (Figure 8).
The cells were stimulated by LPS (1 µg/ml) for 15 min alone or combined with 17β-estradiol (E2, 1 nM), E2 plus tamoxifen (Ta, 10 nM), E2 plus ICI 182780 (ICI, 10 nM), or E2 plus BAPTA (BA, 10 µM). Cells were preincubated with tamoxifen, ICI 182780, or BAPTA for 15 min before the addition of LPS. On lane 5, cells were transfected with siRNA of iER for 72 h before the LPS stimulation. Protein extracts were subjected to western blotting to detect the phosphorylated and total forms of p38 MAPK. The relative activation of p38 was densitometrically evaluated. Representative blots are shown, and the results were verified by at least three independent experiments. P<0.05 compared to LPS and E2.
Discussion
E2 is the major circulating estrogen in pre-menopausal females, and it has a substantial role in the modulation of innate immune function [2], [3]. Understanding the effects of estrogens on macrophage function will provide important insights into the mechanisms by which these sexual steroid hormones affect immune and inflammatory responses in women. Numerous studies have shown that E2 regulates production of proinflammatory cytokines by macrophages [4], [28], [29]. In the present study, we examined the effects of E2 on TNF-α production following LPS stimulation and explored the related mechanisms in BMMs.
We found that the potent macrophage activator LPS increased TNF-α production in BMMs. E2 itself did not affect TNF-α production, but it inhibited LPS-inducible TNF-α production in BMMs. Moreover, E2 selectively attenuated the LPS-induced activation of p38 MAPK, but not ERK1/2 and JNK phosphorylation. The blocking of the LPS-induced phosphorylation of p38 MAPK by E2 might responsible for its inhibitory effect on LPS-induced TNF-α production. The mechanisms by which E2 regulated LPS-induced phosphorylation of p38 MAPK in BMMs were further explored. Two major pathways, generally termed genomic and nongenomic, are known to mediate the effects of E2 on cells [20], [21]. It was possible that E2 inhibited p38 MAPK through a genomic pathway mediated by the classical iER and/or through an iER-independent nongenomic pathway.
According to the classical hypothesis, the cellular effects of estrogens are mediated by iERs, which serve as transcription factors. iERs are expressed in two forms: ERα and ERβ [5], [6]. Although BMMs were shown to express both ERα and ERβ, the inhibitory action of E2 on LPS-stimulated TNF-α production was not sensitive to the iER blockers tamoxifen and ICI 182780, which excluded the possibility that the action of E2 on LPS-induced TNF-α expression is mediated by iER-mediated genomic pathways in BMMs.
Nongenomic actions are initiated at the plasma membrane and are postulated to be mediated by mERs. E2-BSA has been shown to be a plasma membrane impermeable compound and has been used to study the role of surface estrogen receptors in producing nongenomic effects on cellular functions [30]. The present study provided evidence for the presence of mERs on the surface of BMMs. Flow cytometry and CLSM revealed the binding of E2-BSA-FITC on the plasma membranes of intact BMMs. Some authors have stated that mERs are largely identical or structurally related to intracellular ERα or ERβ in various cells [31]–[33]. To test this possibility, intact BMMs were incubated with anti-ERα or anti-ERβ antibody. Neither antibody produced any significant fluorescence on intact BMMs as examined by flow cytometry. Furthermore, the iER blockers tamoxifen and ICI 182780 were not able to inhibit the binding of E2-BSA-FITC to BMMs. In contrast, CLSM revealed that the classic iERs in BMMs were not accessible from the outer surface of intact cells but could only be detected intracellularly. Therefore, it is likely that E2-BSA does not act via membrane receptors that are related to iERs on BMMs. It has been reported that GPR30 may function as a novel transmembrane estrogen receptor and can mediate rapid nongenomic events [25]. The expression of GPR30 on the surface of intact BMMs was evaluated by flow cytometry and CLSM, and the fluorescence patterns were identical to that observed after E2-BSA-FITC incubation. Consistent with these findings, western blotting analysis demonstrated that the GPR30 protein is retained within the plasma membrane fraction. Moreover, the membrane binding of E2-BSA-FITC was competitively inhibited by the specific GPR30 inhibitor G-15. These data suggest that the nongenomic actions of E2 are mediated via GPR30 on membranes of BMMs.
Nongenomic actions manifest themselves as rapid responses of target cells that range from seconds to minutes [24], [34]. Here, nongenomic E2 signaling manifested itself as a rapid rise in [Ca2+]i in the BMMs that occurred within seconds. Moreover, we excluded the possibility that E2 acted through iERs because neither tamoxifen or iER silence affected the rapid Ca2+ increase induced by E2. This E2-induced increase of [Ca2+]i might be initiated on the cell surface via specific E2-receptors. Indeed, the binding of the plasma membrane impermeable E2-BSA also induced a rapid increase in [Ca2+]i, which supports the notion that the surface estradiol receptors on BMMs are functionally coupled to intracellular Ca2+ homeostasis. mERs could mediate the E2-induced rise in [Ca2+]i possibly via the influx of extracellular Ca2+ and/or Ca2+ release from intracellular stores in BMMs. When extracellular Ca2+ was removed with EGTA, the E2-induced [Ca2+]i elevation was totally abolished. Moreover, our data showed that blocking the release of Ca2+ from intracellular stores with neomycin, a phospholipase C inhibitor that binds to phosphoinositides, did not prevent the E2-induced rise in [Ca2+]i. These data suggest that the effects of estradiol are not due to the release of Ca2+ from intracellular Ca2+ stores but are rather due to an influx of extracellular Ca2+. In BMMs, the external Ca2+ influx was not due to diffusion but was channel-mediated because the specific Ca2+ channel blocker Ni2+ completely blocked the E2-induced Ca2+ influx.
MAPK pathways have been reported to be involved in the nongenomic E2 cascade in various types of cells [35], [36]. In the present study, E2 itself did not affect TNF-α production in BMMs. Interestingly, pretreatment of the cells with E2 attenuated the LPS-induced activation of p38 MAPK and subsequent production of TNF-α. These E2 effects were not mediated through iERs; rather, they were mediated through nongenomic signaling that manifested itself as an E2-induced rapid rise in [Ca2+]i in BMMs. This view is supported by the following findings. First, the inhibitory effect of E2 on LPS-induced TNF-α production could not be prevented with iER inhibitors such as ICI 182780 and tamoxifen. Second, the impermeable E2-BSA was capable of producing rapid rises in [Ca2+]i and also exerted a significant inhibitory effect on LPS-induced TNF-α secretion that was similar to the effect of E2. Third, when BMMs were preincubated with the intracellular Ca2+ chelator BAPTA, E2 lost its effect on LPS-induced p38 MAPK phosphorylation. Indeed, BAPTA also abolished the inhibitory effect of E2 on LPS-stimulated TNF-α secretion by blocking intracellular free Ca2+ accumulation. Therefore, E2 exerted its inhibitory effect on LPS-stimulated TNF-α production through nongenomic Ca2+ signaling in BMMs.
In summary, our present study revealed the presence of functional ERs on the membranes of BMMs that did not mediate the classical genomic response; rather, these receptors initiated a novel nongenomic estradiol signaling pathway that involved Ca2+ as an intracellular mediator. This E2-induced nongenomic Ca2+ signaling through mERs that was independent of the classical nuclear ER was responsible for the inhibitory effect of E2 in LPS-induced TNF-α production. As a second messenger, intracellular Ca2+ is essential for many cellular responses. This inhibitory effect of E2 on LPS signaling of macrophages that is mediated by nongenomic Ca2+ signaling will possibly advance the exploitation of the effects of estrogen for several human inflammatory diseases.
Author Contributions
Conceived and designed the experiments: LML ZFW. Performed the experiments: LML YZ KMX XDS. Analyzed the data: LML. Contributed reagents/materials/analysis tools: ZFW YZG. Wrote the paper: LML ZFW.
References
- 1. Straub RH (2007) The complex role of estrogens in inflammation. Endocr Rev 28: 521–574.
- 2. Arroyo IC, Montor JM (2011) Non-reproductive effects of sex steroids: their immunoregulatory role. Curr Top Med Chem 11: 1661–1662.
- 3. Martocchia A, Stefanelli M, Cola S, Falaschi P (2011) Sex steroids in autoimmune diseases. Curr Top Med Chem 11: 1668–1683.
- 4. Härkönen PL, Väänänen HK (2006) Monocyte-macrophage system as a target for estrogen and selective estrogen receptor modulators. Ann N Y Acad Sci 1089: 218–227.
- 5. Lélu K, Delpy L, Robert V, Foulon E, Laffont S, et al. (2010) Endogenous estrogens, through estrogen receptor α, constrain autoimmune inflammation in female mice by limiting CD4+ T-cell homing into the CNS. Eur J Immunol 40: 3489–3498.
- 6. Xing D, Oparil S, Yu H, Gong K, Feng W, et al. (2012) Estrogen modulates NFκB signaling by enhancing IκBα levels and blocking p65 binding at the promoters of inflammatory genes via estrogen receptor-β. PLoS One 7: e36890.
- 7. Ghisletti S, Meda C, Maggi A, Vegeto E (2005) 17beta-estradiol inhibits inflammatory gene expression by controlling NF-kappaB intracellular localization. Mol Cell Biol 25: 2957–2968.
- 8. Montagna P, Soldano S, Brizzolara R, Villaggio B, Triolo P, et al. (2010) Estrogens interfere with leflunomide modulation of cytokine production by human activated monocytes. Ann N Y Acad Sci 1193: 30–35.
- 9. Taylor PR, Martinez-Pomares L, Stacey M, Lin HH, Brown GD, et al. (2005) Macrophage receptors and immune recognition. Annu Rev Immunol 23: 901–944.
- 10. Serbina NV, Jia T, Hohl TM, Pamer EG (2008) Monocyte-mediated defense against microbial pathogens. Annu Rev Immunol 26: 421–452.
- 11. Fujiwara N, Kobayashi K (2005) Macrophages in inflammation. Curr Drug Targets Inflamm Allergy 4: 281–286.
- 12. Elenkov IJ, Chrousos GP (2002) Stress hormones, proinflammatory and antiinflammatory cytokines, and autoimmunity. Ann N Y Acad Sci 966: 290–303.
- 13. Russo C, Polosa R (2005) TNF-alpha as a promising therapeutic target in chronic asthma: a lesson from rheumatoid arthritis. Clin Sci 109: 135–142.
- 14. Rousseau S, Papoutsopoulou M, Symons A, Cook D, Lucocq JM, et al. (2008) TPL2-mediated activation of ERK1 and ERK2 regulates the processing of pre-TNF alpha in LPS-stimulated macrophages. J Cell Sci 121: 149–154.
- 15. Kim KN, Heo SJ, Yoon WJ, Kang SM, Ahn G, et al. (2010) Fucoxanthin inhibits the inflammatory response by suppressing the activation of NF-κB and MAPKs in lipopolysaccharide-induced RAW 264.7 macrophages. Eur J Pharmacol 649: 369–375.
- 16. Zhang Y, Blattman JN, Kennedy NJ, Duong J, Nguyen T, et al. (2004) Regulation of innate and adaptive immune responses by MAP kinase phosphatase 5. Nature 430: 793–797.
- 17. Chi H, Barry SP, Roth RJ, Wu JJ, Jones EA, et al. (2006) Dynamic regulation of pro- and anti-inflammatory cytokines by MAPK phosphatase 1 (MKP-1) in innate immune responses. Proc Natl Acad Sci USA 103: 2274–2279.
- 18. Guma M, Hammaker D, Topolewski K, Corr M, Boyle DL, et al. (2012) Antiinflammatory functions of p38 in mouse models of rheumatoid arthritis: advantages of targeting upstream kinases MKK-3 or MKK-6. Arthritis Rheum 64: 2887–2895.
- 19. Stossi F, Barnett DH, Frasor J, Komm B, Lyttle CR, et al. (2004) Transcriptional profiling of estrogen-regulated gene expression via estrogen receptor (ER) alpha or ER beta in human osteosarcoma cells: distinct and common target genes for these receptors. Endocrinology 145: 3473–3486.
- 20. Edwards DP (2005) Regulation of signal transduction pathways by estrogen and progesterone. Annu Rev Physiol 67: 335–376.
- 21. Hsieh YC, Yu HP, Frink M, Suzuki T, Choudhry MA, et al. (2007) G protein-coupled receptor 30-dependent protein kinase A pathway is critical in nongenomic effects of estrogen in attenuating liver injury after trauma-hemorrhage. Am J Pathol 170: 1210–1218.
- 22. Jaubert AM, Mehebik-Mojaat N, Lacasa D, Sabourault D, Giudicelli Y, et al. (2007) Nongenomic estrogen effects on nitric oxide synthase activity in rat adipocytes. Endocrinology 148: 2444–2452.
- 23. Bouskine A, Nebout M, Mograbi B, Brucker-Davis F, Roger C, et al. (2008) Estrogens promote human testicular germ cell cancer through a membrane-mediated activation of extracellular regulated kinase and protein kinase A. Endocrinology 149: 565–573.
- 24. Zhang L, Li X, Zhao L, Zhang L, Zhang G, et al. (2009) Nongenomic effect of estrogen on the MAPK signaling pathway and calcium influx in endometrial carcinoma cells. J Cell Biochem 106: 553–562.
- 25. Rettew JA, McCall SH 4th, Marriott I (2010) GPR30/GPER-1 mediates rapid decreases in TLR4 expression on murine macrophages. Mol Cell Endocrinol 328: 87–92.
- 26. Liu L, Wang L, Zhao Y, Wang Y, Wang Z, et al. (2006) Testosterone attenuates p38 MAPK pathway during Leishmania donovani infection of macrophages. Parasitol Res 99: 189–193.
- 27. Wang Y, Wang Z, Zhou Y, Liu L, Zhao Y, et al. (2006) Nicotine stimulates adhesion molecular expression via calcium influx and mitogen-activated protein kinases in human endothelial cells. Int J Biochem Cell Biol 38: 170–182.
- 28. Suzuki T, Yu HP, Hsieh YC, Choudhry MA, Bland KI, et al. (2008) Estrogen-mediated activation of non-genomic pathway improves macrophages cytokine production following trauma-hemorrhage. J Cell Physiol 214: 662–672.
- 29. Murphy AJ, Guyre PM, Pioli PA (2010) Estradiol suppresses NF-kappa B activation through coordinated regulation of let-7a and miR-125b in primary human macrophages. J Immunol 184: 5029–5037.
- 30. Stevis PE, Deecher DC, Suhadolnik L, Mallis LM, Frail DE (1999) Differential effects of estradiol and estradiol-BSA conjugates. Endocrinology 140: 5455–5458.
- 31. Revankar CM, Cimino DF, Sklar LA, Arterburn JB, Prossnitz ER (2005) A transmembrane intracellular estrogen receptor mediates rapid cell signaling. Science 307: 1625–1630.
- 32. Pedram A, Razandi M, Sainson RC, Kim JK, Hughes CC, et al. (2007) A conserved mechanism for steroid receptor translocation to the plasma membrane. J Biol Chem 282: 22278–22288.
- 33. Bondar G, Kuo J, Hamid N, Micevych P (2009) Estradiol-induced estrogen receptor-alpha trafficking. J Neurosci 29: 15323–15330.
- 34. Kuo J, Hamid N, Bondar G, Prossnitz ER, Micevych P (2010) Membrane estrogen receptors stimulate intracellular calcium release and progesterone synthesis in hypothalamic astrocytes. J Neurosci 30: 12950–12957.
- 35. Gambino YP, Maymó JL, Pérez-Pérez A, Dueñas JL, Sánchez-Margalet V, et al. (2010) 17Beta-estradiol enhances leptin expression in human placental cells through genomic and nongenomic actions. Biol Reprod 83: 42–51.
- 36. Kulpa J, Chinnappareddy N, Pyle WG (2012) Rapid changes in cardiac myofilament function following the acute activation of estrogen receptor-alpha. PLoS One 7: e41076.