APJ was expressed in cultured CVSMCs

Using RT-PCR, we confirmed that APJ mRNA was expressed in CVSMCs. APJ mRNA expression in human subcutaneous adipose tissue was used as a positive control (Fig. 1A). The results showed a 323 bp fragment specific to APJ. No bands were observed in reactions without RT as template. Using Western blot analyses, we confirmed that APJ proteins were expressed in CVSMCs; APJ expression in human subcutaneous adipose tissue was used as the positive control (Fig. 1). Treatment with siRNA-APJ significantly blocked the expression of APJ protein in CVSMCs since there were few bands detected, while no blockade was observed on treatment with the scrambled APJ siRNA. Our results demonstrated that CVSMCs primarily expressed APJ.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 1. APJ expression in cultured CVSMCs.

(A) APJ mRNA expression in CVSMCs. Total RNA from CVSMCs was subjected to RT-PCR. The PCR products were visualized in a 1.5% agarose gel stained with ethidium bromide. Lane 1 human subcutaneous adipose tissue as a positive control; Lane 2 CVSMCs; Lane 3 RNA of CVSMCs without RT as a negative control. (B) Representative results of Western blot analysis using an anti-APJ antibody. Total cellular protein was subjected to an immunoblotting analysis using anti-APJ antibody. The anti-APJ antibody identified a band at 41 kDa. Lane 1, human subcutaneous adipose tissue as the positive control; lane 2, lysate of CVSMCs; lane 3, lysate from CVSMCs treated with siRNA control; and lane 4, lysate from CVSMCs treated with siRNA-APJ. β-actin was used as the loading control.

https://doi.org/10.1371/journal.pone.0017938.g001

Apelin attenuated the osteoblastic differentiation and mineralization of CVSMCs

Recent data [3]–[5] suggested that arterial calcification resembles a bone mineralization process with expression bone-related molecules. Alkaline phosphatase and osteocalcin are well-established phenotypic markers of osteoblasts. We examined the activity of ALP and osteocalcin secretion during the osteoblastic differentiation of CVSMCs after stimulation by apelin. Treatment with apelin for 48 h significantly inhibited ALP activity in a dose-dependent manner. Figure 2 showed that the activity of ALP decreased significantly (P<0.01) at 10 pM, 100 pM, 1 nM, or 10 nM concentrations of apelin (Fig. 2A). Treatment with 100 pM, 1 nM, or 10 nM apelin caused a significant dose-dependent decrease in osteocalcin production (P<0.01; Fig. 2B). Treatment with 1 nM apelin caused a significant decrease in the expression of the Runx2 protein (Fig. 2D). Figure 2C shows that 10 ng/ml tumor necrosis factor-alpha (TNF-α) accelerated the activity of ALP, and the effects were attenuated by apelin in cultured CVSMCs (p<0.01; Fig. 2C).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 2. Effects of apelin on ALP activity, osteocalcin secretion and Runx2 protein expression in cultured CVSMCs.

Cells were treated with vehicle (serum-free medium) or apelin at 10 pM, 100 pM, 1 nM, or 10 nM for 48 h in serum-free DMEM. ALP activity and osteocalcin secretion were determined and normalized to the total cell protein. (A) The dose response of apelin on ALP activity in cultured CVSMCs. (B) The dose response of apelin on osteocalcin secretion. The group results are shown. (C) The dose response of apelin on ALP activity with control (no TNF-a) or medium containing 10 ng/ml TNF-α in cultured CVSMCs. The bars represent mean ± SD (^##P<0.01 vs. control; **P<0.01 compared with CVSMCs given TNF-α induction without apelin, n = 3). (D) Cells were treated with vehicle (serum-free medium) or apelin at 1 nM for 48 h in serum-free DMEM. Total cellular protein was subjected to immunoblotting analysis using anti-RUNX2 and anti-β-actin antibody.

https://doi.org/10.1371/journal.pone.0017938.g002

Matrix mineralization, a marker for osteoblastic differentiation and function, was assessed by the Alizarin Red S assay. Figure 3A shows a microscopic view of the Alizarin Red S staining, where apelin decreased mineralized nodule formation in 12 d cultures above that seen in control cultures. Figure 3B shows an entire plate view of the Alizarin Red S staining in 24-well plates, where treatment with apelin exhibited decreased Alizarin Red S staining after 12 days in culture compared to those that were not treated with apelin. Figure 3C shows that apelin decreased the calcification seen in CVSMCs, which was measured as CVSMCs calcium levels.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 3. The effects of apelin on the mineralization of the matrix in cultured CVSMCs.

(A) A representative microscopic view of the Alizarin Red S staining at a magnification of 400× for control cells and cells treated with 1 nM apelin in cultures of 12 d duration. (B) A representative entire plate view of the Alizarin Red S staining in 24-well plates for control cells and cells treated with apelin in 12 d cultures. (C) Quantification of the calcium content of the cell layers as measured by the atomic absorption spectroscopy method and normalized to the cellular protein content. The bars represent the mean ± SD (n = 3; **P<0.01 vs. control).

https://doi.org/10.1371/journal.pone.0017938.g003

Intracellular signaling mechanisms mediating apelin inhibition

Mitogen-activated protein kinase (MAPK) and PI3-K/Akt play an essential role in controlling cell differentiation. Therefore, we determined the level of MAPK and PI3-K/Akt signaling induced by apelin in CVSMCs. Apelin stimulated the activity of a specific MAPK, namely ERK, in CVSMCs 5 min after incubation began, as demonstrated by an increase in phosphorylated ERK (p-ERK) levels; the peak activation of ERK occurred at 15 min (Fig. 4A). Treatment with apelin also increased phosphorylated Akt (p-Akt) levels after 5 min of incubation (Fig. 4A). The peak activation of Akt occurred at 15 min. However, apelin had no effects on the activation of c-jun N-terminal kinases (JNK) or p38 MAP kinases (p38), and none of their phosphorylated forms were detected. To exclude the false negative results, we used 50 µM H₂O₂ as positive control, which could activate p38 and JNK in calcifying vascular cells [22].

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 4. Effects of apelin on MAKP and PI3-K/Akt activation in CVSMCs.

Cell lysates were subjected to Western blotting and incubated with antibodies against p-ERK, ERK, p-P38, P38, p-JNK, JNK, p-Akt, and Akt. The representative results are shown. (A) Cells exposed to 1 nM apelin for 5–60 min, or 50 µM H₂O₂ for 15 min as a positive control for P38 and JNK activation. (B) Cells incubated with PD98059 (10 µM) or LY294002 (10 µM) for 2 h prior to treatment with 1 nM apelin for 15 min. (C) Cells treated with scrambled APJ siRNA or APJ siRNA in the presence of 1 nM apelin.

https://doi.org/10.1371/journal.pone.0017938.g004

Fig. 4B shows that the activation of ERK or Akt by apelin in CVSMCs was inhibited by the PD98059 (ERK inhibitor) or LY294002 (PI3-K inhibitor), respectively. Moreover, suppression of APJ with siRNA blocked the activation of ERK and Akt (Fig. 4C). These data indicate that apelin stimulates the ERK and PI3-K/Akt signal transduction pathways via APJ in CVSMCs.

APJ/ERK and APJ/PI3-K/Akt signaling pathway mediated apelin decreased osteoblastic differentiation

In order to illuminate whether APJ, ERK, and PI3-K/Akt signaling was involved in the regulation of the osteoblastic differentiation of CVSMCs, we used siRNA to block the expression of APJ, and signal inhibitors to block the ERK and PI3-K/Akt signaling pathways, respectively. Then, we observed the activity of ALP, which was an important phenotypic marker of osteoblastic differentiation.

Figure 5 showed that the pretreatment of cells with the ERK inhibitor, PD98059, and the PI3-K inhibitor, LY294002, blocked the increase in ALP activity that had been produced by 1 nM apelin. The APJ was efficiently knocked down by RNA interference in CVSMCs (Fig. 1). Suppression of APJ with siRNA-APJ, but not scrambled siRNA, also abolished the increased ALP activity by 1 nM apelin (Fig. 5). These data indicate that the apelin-reduced osteoblastic differentiation of CVSMCs is mediated by the APJ/ERK and APJ/PI3-K/Akt pathways.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 5. ERK and PI3-K signaling pathways mediated the apelin-induced osteoblastic differentiation of CVSMCs.

Cell were incubated with PD98059 (10 µM) or LY 294002 (10 µM) for 2 h prior to treatment with 1 nM apelin. Cells were also treated with the siRNA control or siRNA-APJ in the presence of 1 nM apelin. ALP activity was measured, normalized to the total cellular protein contents. The bars represent the mean ± SD (n = 3; **P<0.01 vs. control).

https://doi.org/10.1371/journal.pone.0017938.g005

Reagents

Synthetic apelin-13 peptide was purchased from the American Peptide Company Inc. (Sunnyvale, CA, USA). The amino acid sequence of apelin-13 is Gln-Arg-Pro-Arg-Leu-Ser-His-Lys-Gly-Pro-Met-Pro-Phe. Recombinant human IGF-I protein was purchased from PEPROTECH (London, UK). Anti-human RUNX2 (also called cbfa1, PEBP2aA) antibody, anti-extracellular signal-regulated kinase (ERK), p-ERK, p-p38, p38, c-jun N-terminal kinase (JNK), p-JNK, Akt, p-Akt antibody, anti-mouse, and rabbit IgG peroxidase conjugate antibodies were purchased from Santa Cruz Biotechnology Inc (Waltham, MA, USA). Anti-human apelin receptor (APJ) antibody was purchased from Abcam Inc. (Cambridge, MA, USA). Anti-β-actin polyclonal antibody was purchased from Sigma (St. Louis, MO, USA). PD98059 and LY294002 were purchased from Calbiochem Corp. (San Diego, CA, USA).

Cell culture and in vitro calcification

Human calcifying vascular smooth muscle cells (CVSMCs) from excess donor vasculature after kidney transplantations were grown from explants of normal arterial tissues, and approved by the Ethics Committee of the Second Xiangya Hospital of Central South University, China. Written informed consent was obtained from each participant. The cells were cultivated as we have previously described [21], and experiments were performed between passages 3 and 6 from the primary culture. Briefly, the arterial tissues were removed under sterile conditions. After the arterial tissues were rinsed several times in Hanks's balanced salt solution, the adventitia was removed; the remaining arterial tissues were minced and digested in 5 ml of digestion solution (0.125 mg/ml elastase, 0.25 mg/ml soybean trypsin inhibitor, 10 mg/ml collagenase I, 2.0 mg/ml crystallized bovine albumin, and 15 mM HEPES) at 37°C for 45 min. The cellular digests were filtered through a sterile 100-mM nylon mesh, centrifuged at 1,000 rpm for 10 min, and washed twice in Dulbecco's modified Eagle's medium (DMEM) containing 10% FBS (Gibco-BRL) before culture in the same medium. CVSMCs were isolated from cultures in which multicellular nodules spontaneously appeared. From these nodule-forming cultures, cells were cloned by limiting dilution and single cell harvesting. Colonial lines were identified as CVSMCs by their positive staining with monoclonal antibody α-actin and by their ability to express high levels of ALP and form calcified nodules.

Adipose tissue

Subcutaneous adipose tissue was obtained from patients who had undergone mammoplastic surgery. Samples were snap-frozen and stored in liquid nitrogen until the extraction of proteins.

Detection of APJ gene expression in cultured CVSMCs by RT-PCR

To investigate the expression of APJ mRNA in CVSMCs, reverse transcription polymerase chain reaction (RT-PCR) was performed as our previous described [39]. Total RNA from cultured CVSMCs and subcutaneous adipose tissue was isolated using Trizol reagent (Gibco) according to the manufacturer's recommended protocol. There is only 1 exon and 1 gene found in the APJ genomic region spanning 4535 bp. We could not obtain intron-spanning primers for APJ, therefore we performed DNase I digestion of isolated total RNA from cultured CVSMCs and subcutaneous adipose, to ensure no genomic contamination. The PCR primers were 5′cacctggtgaagacgctgta 3′ and 5′ taggggatggatttctcgtg yielding a 323 bp fragment. CVSMCs RNA without RT as negative control was included. RT was performed using 1.0 µg total RNA and the Reverse Transcription System (Promega, Madison, WI, USA). PCR was performed as follows: 94°C for 1 min, 58°C for 45 s, and 72°C for 1 min for 35cycles followed by a 10 min incubation at 72°C. Ten microliters of the reaction mixture was electrophoresed on 1.5% agarose gels and stained with ethidium bromide to verify bands. The identities of PCR products were confirmed by direct sequencing using an automatic DNA sequencer (PE Applied Biosystems).

Detection of APJ in cultured CVSMCs by immunoblotting analyses

To investigate the expression of APJ protein in CVSMCs, the cell layers were homogenized with Triton lysis buffer (50 mM Tris-HCl, pH 8.0, containing 150 mM NaCl, 1% Triton X-100, 0.02% sodium azide, 10 mM EDTA, 10 mg/ml aprotinin, and 1 mg/ml aminoethylbenzenesulfonyl fluoride). Homogenized protein (50 mg) was loaded onto a 7.5% polyacrylamide gel. After electrophoresis, the SDS-PAGE-separated proteins were transferred onto a nitrocellulose membrane (Amersham Pharmacia Biotech). The membrane was blocked with 2.5% nonfat milk in PBS and incubated with anti-mouse APJ in PBS for 2 h. The membrane was reprobed with rabbit anti-mouse IgG conjugated with horseradish peroxidase for 1 h. Blots were processed using an ECL kit (Santa Cruz) and exposed to the film. The same membrane was stripped and reprobed with anti-β-actin antibody as a loading control.

Analysis of alkaline phosphatase activity and osteocalcin secretion in cultured CVSMCs

Calcifying CVSMCs were washed three times with PBS, scraped into 1 ml of 10 mM Tris-Cl buffer (pH 7.6) that contained 0.1% Triton-X-100 on ice, and centrifuged. The lysates were homogenized. Then, ALP activity was assayed by the spectrophotometric measurement of p-nitrophenol release at 37°C. ALP activity was normalized to the total protein content of the cell layer. Osteocalcin released into the culture media was measured using a specific radioimmunoassay kit (DiaSorin, Stillwater, MN, USA). To normalize protein expression to the total cellular protein, a fraction of the lysate solution was used in a Bradford protein assay.

Measurement of mineralized matrix formation

For Alizarin Red S staining, CVSMCs in 24-well plates were cultured in medium that contained either 1 nM apelin or vehicle for 12 days. Then, the extent of mineralized matrix was determined by Alizarin Red S staining [59]. Briefly, cells were fixed in 70% ethanol for 1 h at room temperature and stained with 40 mM Alizarin Red S for 10 min. Next, cell preparations were washed with PBS to eliminate nonspecific staining. The stained matrix was assessed using a Nikon Diaphot inverted microscope and samples were photographed using a Nikon 35-mm camera (Nikon, Tokyo, Japan).

For the quantification of calcium levels, cells were washed with PBS and decalcified with 0.6 N HCl for 24 h, Calcium content was determined by measuring the concentrations of calcium in the HCl supernatant by atomic absorption spectroscopy. After decalcification, the cells were washed three times with PBS and the cells were solubilized with 0.1 N NaOH/0.1% SDS. The protein content was measured with a Bradford protein assay. The calcium content of the cell layer was normalized to the protein content.

RNA interference against APJ

Two pairs of small-interfering RNAs (siRNAs) and control siRNAs were synthesized by Genesil Biotechnology Co. (Wuhan, China) as previously described [39]. The targets were GGUGCAGUGCUACAUGGACdTdT (for human APJ siRNA) and AUGCUGCGAGCUAGAUCGGdTdT (for scrambled human APJ siRNA). For gene knockdown experiments, CVSMCs were plated into 60-mm-diameter dishes and cultured for 24 h in medium without antibiotics. Cells were transfected with siRNAs (1 nmol per well) using Lipofectamine 2000 (Invitrogen Inc. Carlsbad, CA, USA) according to the instructions of the manufacturer. After 24 h of culture, cells were retransfected with siRNAs or controls and then recultured for another 48 h. Protein expression was analyzed by Western blotting.

Detection of MAPK and PI3-K/Akt activation by Western blot analysis

CVSMCs were initially treated with 1 nM apelin for between 5–60 min. Then, cellular monolayers were washed quickly with cold PBS that contained 5 mM of EDTA and 0.1 mM Na₃VO₄, and lysed with a lysis buffer that consisted of 20 mM Tris–HCl (pH 7.5), 150 mM NaCl, 1% Triton X-100, 10 mM of NaH₂PO₄, 10% glycerol, 2 mM Na₃VO₄, 10 mM NaF, 1 mM ABSF, 10 mg/ml leupeptin and 10 mg/ml aprotinin. Western blotting was performed as described above. Proteins were then transferred to a nitrocellulose membrane. The membrane was incubated with anti-p-p38, -p38, -p-ERK, -ERK, -p-JNK, -JNK, -p-Akt and -Akt primary antibodies at 1∶500 in PBS for 2 h. The membranes were then incubated with goat anti-mouse or rabbit IgG antibody conjugated with horseradish peroxidase at 1∶1000 in PBS for 1 h. Blots were processed using an ECL Kit (Santa Cruz) and exposed to X-ray film.

Detection of signaling pathways involved in the apelin-attenuated osteoblastic differentiation of CVSMCs

To determine the downstream intracellular signaling pathways affected by apelin treatment, we explored the relationship between extracellular signal-regulated kinases (ERK) and PI3-K phosphorylation of CVSMCs and treatment with apelin. CVSMCs were pretreated with 10 µM PD98059 (an ERK inhibitor) or 10 µM LY294002 (a PI3-K inhibitor) for 2 h prior to apelin treatment. ALP activities were assessed after 48 h.

Statistical analyses

The results of the experiments were normalized relative to total protein levels, as determined by Bradford's method. The data are expressed as means ± standard deviation (SD). Comparisons between values of more than two groups were performed by an analysis of variance (one-way ANOVA). P-values of less than 0.05 were considered to be statistically significant in all cases. All experiments were repeated at least three times, and representative experiments are shown in the Figures.